Review

polyclonal goat anti human ace2 antibody (R&D Systems)

R&D Systems is a verified supplier

R&D Systems manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

R&D Systems polyclonal goat anti human ace2 antibody
Polyclonal Goat Anti Human Ace2 Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 455 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/goat+anti+ace2+polyclonal+antibody/Human%2FMouse%2FRat%2FHamster+ACE-2+Antibody/10__3389_slash_fddsv__2024__1416728-68-37-42
Average 96 stars, based on 455 article reviews

polyclonal goat anti human ace2 antibody - by Bioz Stars, 2026-10

96/100 stars

Images

Staining:

Article Title: SARS-CoV-2 spike L452R variant evades cellular immunity and increases infectivity
Article Snippet: After expansion, the expression level of surface ACE2 was verified by a FACS Canto II (BD Biosciences). .. A goat anti-ACE2 polyclonal antibody (R&D Systems, cat# AF933) and an APC-conjugated donkey anti-goat IgG (R&D Systems, cat# F0108) were used for surface ACE2 staining. .. Normal goat IgG (R&D Systems, cat# AB-108-C) was used as the negative control for this assay.

Article Title: SARS-CoV-2 spike L452R variant evades cellular immunity and increases infectivity.
Article Snippet: To prepare the plasmids with the mutated RBD, megaprimers were amplified by PCR using the KAPA HiFi HotStart ReadyMix kit (Roche, cat# KK2601) with the following primers according to the manufacturer’s protocol: RBD L452R forward:50-GGACAGCAAGGTGGGAGGCAACTA CAACTACAG ATACAG ACTGTT CAGGAAGAGCAAC-30; RBD Y453F reverse: 50-CTC AAA TGG TTT CAG GTT GCT CTT CCT GAA CAG TCT GAA GAG GTA GTT GTA GTT GCC TCC C-30; RBD N501Y reverse: 50-GTA TGGTTGGTAGCCCACTCCATAGGT TGGTTGGAAGCCATAGGATTG-30; pCT_seq reverse: 50-CATGGGAAAACA TGT TGT TTA CGG AG-30; and pCTCON_seq forward: 50-GCA GCC CCA TAA ACA CAC AGT AT-30. .. A goat anti-ACE2 polyclonal antibody (R&D Systems, cat# AF933) and an APC-conjugated donkey anti-goat IgG (R&D Systems, cat# F0108) were used for surface ACE2 staining. .. Analysis of the binding affinity of the SARS-CoV-2 S RBD variants for human ACE2 by yeast surface display The pJYDC1-based yeast display plasmids expressing SARS-CoV-2 RBD and its mutants were transformed into yeast (Saccharomyces cerevisiae; strain EBY100, ATCCMYA-4941) and selected by growth on SD-Wplates (Peleg andUnger, 2014).

Article Title: Potential Role of APOBEC3 Family Proteins in SARS-CoV-2 Replication
Article Snippet: After expansion, the expression level of surface ACE2 was verified by a FACS Canto II (BD Biosciences). .. A goat anti-ACE2 polyclonal antibody (R&D Systems, Minneapolis, MN, USA, Cat# AF933, 1:50) and an APC-conjugated donkey anti-goat IgG (R&D Systems, Cat# F0108, 1:50) were used for surface ACE2 staining ( A). .. Normal goat IgG (R&D Systems, Cat# AB-108-C, 1:100) was used as the negative control for this assay.

Article Title: An emerging SARS-CoV-2 mutant evading cellular immunity and increasing viral infectivity
Article Snippet: To prepare the target cells for pseudovirus infection, HEK293T cells (1 × 10 6 cells) were cotransfected with 250 ng of pC-TMPRSS2 ( ) and 500 ng of pC-ACE2 (a human ACE2 expression plasmid) ( ) using Lipofectamine 2000 (Thermo Fisher Scientific, cat# 11668019) according to the manufacturer’s protocol. .. For the staining of surface ACE2, a goat anti-ACE2 polyclonal antibody (R&D systems, cat# AF933) and an APC-conjugated donkey anti-goat IgG (R&D systems, cat# F0108) were used. .. Two days postinfection, the infected cells were lysed with One-Glo luciferase assay system (Promega, cat# E6130), and the luminescent signal was measured by using a CentroXS3 plate reader (Berthhold Technologies).

other:

Article Title: PLSCR1 is a cell-autonomous defence factor against SARS-CoV-2 infection
Article Snippet: Goat anti-ACE2 polyclonal antibody (AF933) was purchased from R&D Systems.

Article Title: PLSCR1 is a cell-autonomous defence factor against SARS-CoV-2 infection.
Article Snippet: Goat anti-ACE2 polyclonal antibody (AF933) was purchased from R&D Systems.

Article Title: An Emerging SARS-CoV-2 Mutant Evades Cellular Immunity and Increases Infectivity
Article Snippet: 1 An emerging SARS-CoV-2 mutant evades cellular immunity and increases 2 infectivity 3 4 Chihiro Motozono1, Mako Toyoda1, Jiri Zahradnik2, Terumasa Ikeda3, Akatsuki 5 Saito4,5,6, Toong Seng Tan1, Isaac Ngare1, Hesham Nasser3,7, Izumi Kimura8, Keiya 6 Uriu8, Yusuke Kosugi8, Shiho Torii9,10,11, Akiko Yonekawa12, Nobuyuki Shimono12, 7 Yoji Nagasaki13, Rumi Minami14, Takashi Toya15, Noritaka Sekiya16,17, Takasuke 8 Fukuhara18, Yoshiharu Matsuura9,10,11, Gideon Schreiber2, The Genotype to 9 Phenotype Japan (G2P-Japan) consortium, So Nakagawa19,20*, Takamasa Ueno1*, 10 Kei Sato8,20,21,22* 11 12 1 Division of Infection and immunity, Joint Research Center for Human Retrovirus 13 infection, Kumamoto University, Kumamoto 8600811, Japan 14 2 Department of Biological Chemistry, Weizmann Institute of Science, Rehovot 15 76100, Israel 16 3 Division of Molecular Virology and Genetics, Joint Research Center for Human 17 Retrovirus infection, Kumamoto University, Kumamoto 8600811, Japan 18 4 Department of Veterinary Science, Faculty of Agriculture, University of Miyazaki, 19 Miyazaki 8892192, Japan 20 5 Center for Animal Disease Control, University of Miyazaki, Miyazaki 8892192, 21 Japan 22 6 Graduate School of Medicine and Veterinary Medicine, University of Miyazaki, 23 Miyazaki 8892192, Japan 24 7 Department of Clinical Pathology, Faculty of Medicine, Suez Canal University, 25 Ismailia 41511, Egypt 26 8 Division of Systems Virology, Department of Infectious Disease Control, 27 International Research Center for Infectious Diseases, The Institute of Medical 28 Science, The University of Tokyo, Tokyo 1088639, Japan 29 9 Department of Molecular Virology, Research Institute for Microbial Diseases, 30 Osaka University, Osaka 5650871, Japan 31 10 Division of Microbiology and Immunology, Center for Infectious Diseases 32 Education and Research, Osaka University, Osaka 5650871, Japan 33 11 Laboratory of Virus Control, Research Institute for Microbial Diseases,Osaka 34 University, Osaka 5650871, Japan 35 12 Department of Medicine and Biosystemic Science, Graduate School of Medical 36 Sciences, Kyushu University, Fukuoka 8128582, Japan 37 13 Division of Infectious Diseases, Clinical Research Institute, National 38 Hospitalization Organization, Kyushu Medical Center, Fukuoka 8108563, Japan 39 14 Internal Medicine, Clinical Research Institute, National Hospital Organization, 40 Kyushu Medical Center, Fukuoka 8108563, Japan

Image Search Results

Validation of expression levels for ACE2 protein and A3 mRNAs in THP-1 parent and A3A -to- A3G -null THP-1 cells. ( A ) ACE2 protein expression levels on the surface of THP-1 parent and THP-1#11-4 ( A3A -to- A3G -null THP-1) cells. The ACE2 gene was introduced by a retroviral vector, and the expression levels of the surface ACE2 protein were detected by an anti-ACE2 polyclonal antibody (red). The number in each graph shows the percentage of ACE2 + cells compared to those stained by isotype control (gray). ( B ) A3 mRNA expression levels in Calu-3 (gray), THP-1-ACE2 (blue), and THP-1-ACE2#11-4 (red) cells. A3 mRNA expression levels were quantified by RT-qPCR and normalized to TBP mRNA levels. Each bar represents the average of three independent experiments with Standard deviation (SD). Statistical significance was determined using the two-sided unpaired t -test. *, p < 0.05 compared to THP-1 parent cells.

Journal: Viruses

Article Title: Potential Role of APOBEC3 Family Proteins in SARS-CoV-2 Replication

doi: 10.3390/v16071141

Figure Lengend Snippet: Validation of expression levels for ACE2 protein and A3 mRNAs in THP-1 parent and A3A -to- A3G -null THP-1 cells. ( A ) ACE2 protein expression levels on the surface of THP-1 parent and THP-1#11-4 ( A3A -to- A3G -null THP-1) cells. The ACE2 gene was introduced by a retroviral vector, and the expression levels of the surface ACE2 protein were detected by an anti-ACE2 polyclonal antibody (red). The number in each graph shows the percentage of ACE2 + cells compared to those stained by isotype control (gray). ( B ) A3 mRNA expression levels in Calu-3 (gray), THP-1-ACE2 (blue), and THP-1-ACE2#11-4 (red) cells. A3 mRNA expression levels were quantified by RT-qPCR and normalized to TBP mRNA levels. Each bar represents the average of three independent experiments with Standard deviation (SD). Statistical significance was determined using the two-sided unpaired t -test. *, p < 0.05 compared to THP-1 parent cells.

Article Snippet: A goat anti-ACE2 polyclonal antibody (R&D Systems, Minneapolis, MN, USA, Cat# AF933, 1:50) and an APC-conjugated donkey anti-goat IgG (R&D Systems, Cat# F0108, 1:50) were used for surface ACE2 staining ( A).

Techniques: Biomarker Discovery, Expressing, Retroviral, Plasmid Preparation, Staining, Control, Quantitative RT-PCR, Standard Deviation

SARS-CoV-2 replication in THP-1 parent and A3A -to- A3G -null THP-1 cells. ( A ) Replication kinetics of the Wuhan, BA.1, and BA.5 variants produced from THP-1 parent and THP-1#11-4 ( A3A -to- A3G -null THP-1) cells without (blue line) or with (red line) ACE2 protein expression. The SARS-CoV-2 N gene was quantified by RT-qPCR to monitor the viral RNA copy number across the indicated time points. Each timepoint represents the average of four independent experiments with SD. ( B ) Passage experiments. The SARS-CoV-2 N gene in the cell culture supernatants produced from THP-1-ACE2 or THP-1-ACE2#11-4 ( A3A -to- A3G -null THP-1) cells at 96 h postinfection of each passage were quantified by RT-qPCR to monitor the viral RNA copy number of the Wuhan (gray), BA.1 (blue), and BA.5 (red) variants. Each bar represents the average of three independent experiments with SD.

Journal: Viruses

Article Title: Potential Role of APOBEC3 Family Proteins in SARS-CoV-2 Replication

doi: 10.3390/v16071141

Figure Lengend Snippet: SARS-CoV-2 replication in THP-1 parent and A3A -to- A3G -null THP-1 cells. ( A ) Replication kinetics of the Wuhan, BA.1, and BA.5 variants produced from THP-1 parent and THP-1#11-4 ( A3A -to- A3G -null THP-1) cells without (blue line) or with (red line) ACE2 protein expression. The SARS-CoV-2 N gene was quantified by RT-qPCR to monitor the viral RNA copy number across the indicated time points. Each timepoint represents the average of four independent experiments with SD. ( B ) Passage experiments. The SARS-CoV-2 N gene in the cell culture supernatants produced from THP-1-ACE2 or THP-1-ACE2#11-4 ( A3A -to- A3G -null THP-1) cells at 96 h postinfection of each passage were quantified by RT-qPCR to monitor the viral RNA copy number of the Wuhan (gray), BA.1 (blue), and BA.5 (red) variants. Each bar represents the average of three independent experiments with SD.

Techniques: Produced, Expressing, Quantitative RT-PCR, Cell Culture

SARS-CoV-2 infectivity produced from THP-1 parent and A3A -to- A3G -null THP-1 cells during passage experiments. ( A ) Representative pictures of plaque assay. Cell culture supernatants obtained from the passage experiments for the Wuhan variant were also used for plaque assay with serial 10-times dilution. ( B ) PFU/mL of the Wuhan variant produced from THP-1-ACE2 (gray) or THP-1-ACE2#11-4 ( A3A -to- A3G -null THP-1) (blue) cells at 96 h postinfection during passage experiments.

Journal: Viruses

Article Title: Potential Role of APOBEC3 Family Proteins in SARS-CoV-2 Replication

doi: 10.3390/v16071141

Figure Lengend Snippet: SARS-CoV-2 infectivity produced from THP-1 parent and A3A -to- A3G -null THP-1 cells during passage experiments. ( A ) Representative pictures of plaque assay. Cell culture supernatants obtained from the passage experiments for the Wuhan variant were also used for plaque assay with serial 10-times dilution. ( B ) PFU/mL of the Wuhan variant produced from THP-1-ACE2 (gray) or THP-1-ACE2#11-4 ( A3A -to- A3G -null THP-1) (blue) cells at 96 h postinfection during passage experiments.

Techniques: Infection, Produced, Plaque Assay, Cell Culture, Variant Assay

Analysis of mutations in SARS-CoV-2 genomes produced from THP-1 parent and A3A -to- A3G -null THP-1 cells during passage experiments. SARS-CoV-2 genomic RNA was isolated and subjected to WGS. Sample 1 to 4: Wuhan variant from passage 1 of THP-1-ACE2 cells. Sample 5 to 8: Wuhan variant from passage 5 of THP-1-ACE2 cells. Sample 9 to 12: Wuhan variant from passage 1 of THP-1-ACE2#11-4 ( A3A -to- A3G -null THP-1) cells. Sample 13 and 14: Wuhan variant from passage 3 of THP-1-ACE2#11-4 cells. Green boxes on the top show each SARS-CoV-2 ORF gene with nucleotide position.

Journal: Viruses

Article Title: Potential Role of APOBEC3 Family Proteins in SARS-CoV-2 Replication

doi: 10.3390/v16071141

Figure Lengend Snippet: Analysis of mutations in SARS-CoV-2 genomes produced from THP-1 parent and A3A -to- A3G -null THP-1 cells during passage experiments. SARS-CoV-2 genomic RNA was isolated and subjected to WGS. Sample 1 to 4: Wuhan variant from passage 1 of THP-1-ACE2 cells. Sample 5 to 8: Wuhan variant from passage 5 of THP-1-ACE2 cells. Sample 9 to 12: Wuhan variant from passage 1 of THP-1-ACE2#11-4 ( A3A -to- A3G -null THP-1) cells. Sample 13 and 14: Wuhan variant from passage 3 of THP-1-ACE2#11-4 cells. Green boxes on the top show each SARS-CoV-2 ORF gene with nucleotide position.

Techniques: Produced, Isolation, Variant Assay

Downregulation of ACE2 by the S protein of SARS-CoV-2. ( A ) Cell lysates from ACE2-expressing 293T cells transfected with either an empty vector or an S protein expression vector were subjected to Western blotting using anti-S1, and-ACE2, and anti-β-actin antibodies. Relative band intensities of ACE2 and the S protein are shown in the lower panel. Band intensities of ACE2 or the S protein without the S protein or ACE2 are shown as 1.0, respectively. ( B ) S protein and ACE2-Venus were co-expressed in 293T cells and stained with anti-S1 antibody. ( Left ) ACE2-Venus expression in the absence (red) or presence (blue) of S protein was analyzed in S1-positive cell population. ( Right ) S1 expression in the absence (blue) or presence (yellow) of ACE2-Venus was analyzed. Dotted line represents the no-antibody-control, non-transfected 293T cells.

Journal: International Journal of Molecular Sciences

Article Title: Differential Ability of Spike Protein of SARS-CoV-2 Variants to Downregulate ACE2

doi: 10.3390/ijms25021353

Figure Lengend Snippet: Downregulation of ACE2 by the S protein of SARS-CoV-2. ( A ) Cell lysates from ACE2-expressing 293T cells transfected with either an empty vector or an S protein expression vector were subjected to Western blotting using anti-S1, and-ACE2, and anti-β-actin antibodies. Relative band intensities of ACE2 and the S protein are shown in the lower panel. Band intensities of ACE2 or the S protein without the S protein or ACE2 are shown as 1.0, respectively. ( B ) S protein and ACE2-Venus were co-expressed in 293T cells and stained with anti-S1 antibody. ( Left ) ACE2-Venus expression in the absence (red) or presence (blue) of S protein was analyzed in S1-positive cell population. ( Right ) S1 expression in the absence (blue) or presence (yellow) of ACE2-Venus was analyzed. Dotted line represents the no-antibody-control, non-transfected 293T cells.

Article Snippet: Anti-ACE2 goat polyclonal antibody (Cat. AF933) was purchased from R&D Systems (Minneapolis, Minnesota, USA).

Techniques: Expressing, Transfection, Plasmid Preparation, Western Blot, Staining, Control

Effect of the over-expression of ACE2 in pseudovirus with S protein and authentic SARS-CoV-2 infection. ( A ) Effect of over-expression of ACE2 in pseudovirus infection with SARS-CoV-2 S protein. HIV-1 pseudoviruses with D614G S protein produced in the absence (white bar) or presence (shaded bar) of FLAG-tagged ACE2 were infected into ACE2-expressing 293T cells. The luciferase activities of infected cells were measured after 48 h of infection in triplicate experiments. ( B ) Western blot analyses of pseudovirus-infected cells and the virions in the absence and presence of FLAG-tagged ACE2. Pseudovirus with S protein or VSVG were produced in 293T cells in the absence or presence of ACE2. Cell lysates and pseudoviruses were analyzed by Western blotting using anti-FLAG, anti-S1, anti-VSVG, anti-ACE2, anti-HIV-1 p24, and anti-β-actin antibodies. To monitor the production of psuedovirions, HIV-1 p55 gag precursor and the final product p24 are shown. The positions of the molecular mass marker (kDa) are indicated on the right. ( C ) The 293T cells (No ACE2), ACE2-expressing parental 293T (ACE2 parent), or highly ACE2-expressing 293T cells (ACE2 high) were stained with an anti-ACE2 antibody and analyzed by flow cytometry. ( D ) ACE2 parent and high-ACE2-293T cells were infected with authentic SARS-CoV-2. Viral RNA titers were determined using real-time PCR in the indicated time in triplicate experiments.

Journal: International Journal of Molecular Sciences

Article Title: Differential Ability of Spike Protein of SARS-CoV-2 Variants to Downregulate ACE2

doi: 10.3390/ijms25021353

Figure Lengend Snippet: Effect of the over-expression of ACE2 in pseudovirus with S protein and authentic SARS-CoV-2 infection. ( A ) Effect of over-expression of ACE2 in pseudovirus infection with SARS-CoV-2 S protein. HIV-1 pseudoviruses with D614G S protein produced in the absence (white bar) or presence (shaded bar) of FLAG-tagged ACE2 were infected into ACE2-expressing 293T cells. The luciferase activities of infected cells were measured after 48 h of infection in triplicate experiments. ( B ) Western blot analyses of pseudovirus-infected cells and the virions in the absence and presence of FLAG-tagged ACE2. Pseudovirus with S protein or VSVG were produced in 293T cells in the absence or presence of ACE2. Cell lysates and pseudoviruses were analyzed by Western blotting using anti-FLAG, anti-S1, anti-VSVG, anti-ACE2, anti-HIV-1 p24, and anti-β-actin antibodies. To monitor the production of psuedovirions, HIV-1 p55 gag precursor and the final product p24 are shown. The positions of the molecular mass marker (kDa) are indicated on the right. ( C ) The 293T cells (No ACE2), ACE2-expressing parental 293T (ACE2 parent), or highly ACE2-expressing 293T cells (ACE2 high) were stained with an anti-ACE2 antibody and analyzed by flow cytometry. ( D ) ACE2 parent and high-ACE2-293T cells were infected with authentic SARS-CoV-2. Viral RNA titers were determined using real-time PCR in the indicated time in triplicate experiments.

Article Snippet: Anti-ACE2 goat polyclonal antibody (Cat. AF933) was purchased from R&D Systems (Minneapolis, Minnesota, USA).

Techniques: Over Expression, Infection, Produced, Expressing, Luciferase, Western Blot, Marker, Staining, Flow Cytometry, Real-time Polymerase Chain Reaction

Interaction of ACE2 with the S protein of SARS-CoV-2 in 293T cells. ( A ) Cell lysates from the 293T cells transfected with FLAG-tagged ACE2 and S protein were analyzed by Western blotting using ant-FLAG, anti-S1, anti-β-actin antibodies. Immunoprecipitation (IP) was performed using anti-FLAG and anti-S1 antibodies with protein G-Sepharose beads, and the blots were analyzed with anti-S1 and anti-FLAG antibodies, respectively. The positions of the molecular mass marker (kDa) are indicated on the right. ( B ) Confocal microscopic images of the 293T cells transfected with ACE2-Venus (green) and the S protein. Panels show the counterstaining of cell nuclei with DAPI ( a ), ACE2-Venus ( b ), S protein ( c ), and merged image ( d ). Scale bars correspond to 10 μm.

Journal: International Journal of Molecular Sciences

Article Title: Differential Ability of Spike Protein of SARS-CoV-2 Variants to Downregulate ACE2

doi: 10.3390/ijms25021353

Figure Lengend Snippet: Interaction of ACE2 with the S protein of SARS-CoV-2 in 293T cells. ( A ) Cell lysates from the 293T cells transfected with FLAG-tagged ACE2 and S protein were analyzed by Western blotting using ant-FLAG, anti-S1, anti-β-actin antibodies. Immunoprecipitation (IP) was performed using anti-FLAG and anti-S1 antibodies with protein G-Sepharose beads, and the blots were analyzed with anti-S1 and anti-FLAG antibodies, respectively. The positions of the molecular mass marker (kDa) are indicated on the right. ( B ) Confocal microscopic images of the 293T cells transfected with ACE2-Venus (green) and the S protein. Panels show the counterstaining of cell nuclei with DAPI ( a ), ACE2-Venus ( b ), S protein ( c ), and merged image ( d ). Scale bars correspond to 10 μm.

Article Snippet: Anti-ACE2 goat polyclonal antibody (Cat. AF933) was purchased from R&D Systems (Minneapolis, Minnesota, USA).

Techniques: Transfection, Western Blot, Immunoprecipitation, Marker

The degradation of ACE2 by the S protein in the lysosomal compartment via the endocytic pathway. ( A ) ACE2-expressing 293T cells were transfected with the S protein in the presence of various inhibitors targeting protein degradation pathways. Cell lysates were analyzed by Western blotting using anti-S1, anti-ACE2, and anti-β-actin antibodies. The positions of the molecular mass marker (kDa) are indicated on the right. The relative band intensities of ACE2 are shown on the bottom of ACE2 image. The band intensity of ACE2 without the S protein is shown as 1.0. ( B ) Confocal microscopic images of 293T cells transfected with ACE2-Venus and Rab9a-mCherry. The panels show counterstaining with cell nuclei with DAPI ( a ), ACE2-Venus ( b ), Rab9a-mCherry ( c ), and a merged image ( d ) in the absence ( left ) and presence ( right ) of the S protein. Scale bars correspond to 10 μm.

Journal: International Journal of Molecular Sciences

Article Title: Differential Ability of Spike Protein of SARS-CoV-2 Variants to Downregulate ACE2

doi: 10.3390/ijms25021353

Figure Lengend Snippet: The degradation of ACE2 by the S protein in the lysosomal compartment via the endocytic pathway. ( A ) ACE2-expressing 293T cells were transfected with the S protein in the presence of various inhibitors targeting protein degradation pathways. Cell lysates were analyzed by Western blotting using anti-S1, anti-ACE2, and anti-β-actin antibodies. The positions of the molecular mass marker (kDa) are indicated on the right. The relative band intensities of ACE2 are shown on the bottom of ACE2 image. The band intensity of ACE2 without the S protein is shown as 1.0. ( B ) Confocal microscopic images of 293T cells transfected with ACE2-Venus and Rab9a-mCherry. The panels show counterstaining with cell nuclei with DAPI ( a ), ACE2-Venus ( b ), Rab9a-mCherry ( c ), and a merged image ( d ) in the absence ( left ) and presence ( right ) of the S protein. Scale bars correspond to 10 μm.

Article Snippet: Anti-ACE2 goat polyclonal antibody (Cat. AF933) was purchased from R&D Systems (Minneapolis, Minnesota, USA).

Techniques: Expressing, Transfection, Western Blot, Marker

The differential ability of the S protein from various VOCs to downregulate ACE2. ( A ) ( upper ) Cell lysates from ACE2-expressing 293T cells transfected with S protein from previous VOCs were analyzed by Western blotting using ant-ACE2, anti-S1, and anti-β-actin antibodies. The positions of the molecular mass marker (kDa) are indicated on the right. ( lower ) The relative band intensities of ACE2 in the presence of the S protein from previous VOCs in Western blotting were analyzed and compared using Image Lab software (BioRad) in triplicate experiments. The band intensity of ACE2 without the S protein is shown as 1.0. Bars depicts means and standard deviation (** p < 0.01, *** p < 0.001 using unpaired t -test). ( B ) The S protein and ACE2-Venus were co-expressed in 293T cells and stained with anti-RBD polyclonal antibody. The ACE2 downregulation activity of the S protein of previous VOCs was determined using the mean fluorescence intensity (MFI) of ACE-Venus protein in the S-protein-positive cell population. The column and bar indicate means and standard deviation in triplicate experiments (** p < 0.01 using unpaired t -test). ( C ) S protein and ACE-nLuc were co-expressed in 293T cells in the presence or absence of the S protein from previous VOCs. The ACE2 downregulation activity of the S protein from previous VOCs was calculated using the nanoluciferase activity of the wild-type S proteins as 100% (** p < 0.01, *** p < 0.001 using unpaired t -test).

Journal: International Journal of Molecular Sciences

Article Title: Differential Ability of Spike Protein of SARS-CoV-2 Variants to Downregulate ACE2

doi: 10.3390/ijms25021353

Figure Lengend Snippet: The differential ability of the S protein from various VOCs to downregulate ACE2. ( A ) ( upper ) Cell lysates from ACE2-expressing 293T cells transfected with S protein from previous VOCs were analyzed by Western blotting using ant-ACE2, anti-S1, and anti-β-actin antibodies. The positions of the molecular mass marker (kDa) are indicated on the right. ( lower ) The relative band intensities of ACE2 in the presence of the S protein from previous VOCs in Western blotting were analyzed and compared using Image Lab software (BioRad) in triplicate experiments. The band intensity of ACE2 without the S protein is shown as 1.0. Bars depicts means and standard deviation (** p < 0.01, *** p < 0.001 using unpaired t -test). ( B ) The S protein and ACE2-Venus were co-expressed in 293T cells and stained with anti-RBD polyclonal antibody. The ACE2 downregulation activity of the S protein of previous VOCs was determined using the mean fluorescence intensity (MFI) of ACE-Venus protein in the S-protein-positive cell population. The column and bar indicate means and standard deviation in triplicate experiments (** p < 0.01 using unpaired t -test). ( C ) S protein and ACE-nLuc were co-expressed in 293T cells in the presence or absence of the S protein from previous VOCs. The ACE2 downregulation activity of the S protein from previous VOCs was calculated using the nanoluciferase activity of the wild-type S proteins as 100% (** p < 0.01, *** p < 0.001 using unpaired t -test).

Article Snippet: Anti-ACE2 goat polyclonal antibody (Cat. AF933) was purchased from R&D Systems (Minneapolis, Minnesota, USA).

Techniques: Expressing, Transfection, Western Blot, Marker, Software, Standard Deviation, Staining, Activity Assay, Fluorescence

ACE2 downregulation and fusion activities of chimeras between the S protein from the Omicron and Delta variants.

Journal: International Journal of Molecular Sciences

Article Title: Differential Ability of Spike Protein of SARS-CoV-2 Variants to Downregulate ACE2

doi: 10.3390/ijms25021353

Figure Lengend Snippet: ACE2 downregulation and fusion activities of chimeras between the S protein from the Omicron and Delta variants.

Article Snippet: Anti-ACE2 goat polyclonal antibody (Cat. AF933) was purchased from R&D Systems (Minneapolis, Minnesota, USA).

Techniques: Activity Assay

ACE2 downregulation and fusion activities of Delta, Omicron, and wild-type S with mutations.

Journal: International Journal of Molecular Sciences

Article Title: Differential Ability of Spike Protein of SARS-CoV-2 Variants to Downregulate ACE2

doi: 10.3390/ijms25021353

Figure Lengend Snippet: ACE2 downregulation and fusion activities of Delta, Omicron, and wild-type S with mutations.

Article Snippet: Anti-ACE2 goat polyclonal antibody (Cat. AF933) was purchased from R&D Systems (Minneapolis, Minnesota, USA).

Techniques: Activity Assay

Review

polyclonal goat anti human ace2 antibody (R&D Systems)

Structured Review

Images

Related Articles

Staining:

other:

Similar Products

Image Search Results